Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.050081 |
Chromosome: | chromosome 9 |
Location: | 2878099 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390678 | (1 of 1) K17500 - integrin-linked kinase-associated serine/threonine phosphatase 2C [EC:3.1.3.16] (ILKAP) | intron | |
Cre09.g801025 | intron | ||
lncRNA_TCONS_00128634 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCTCAGGAGGCGCTGGTCCGCAAGATTGCGCAGCTGGAGGCGGCGGC |
Internal bar code: | TTGTAGGTCACGTGTGAACGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1608 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCACGACCATGAACGATT |
Suggested primer 2: | GCCTTGCCTTTGCTTTTCGA |