| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050100 |
| Chromosome: | chromosome 10 |
| Location: | 2177787 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433500 | PWR10 | (1 of 1) IPR003590//IPR006502 - Leucine-rich repeat, ribonuclease inhibitor subtype // Protein of unknown function PDDEXK-like; PWR motif protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAGCCTGGGGACGGCGCGGTGCCCTTTCCAGTCGTGCACGTGCACGC |
| Internal bar code: | TAGCCGGCAGATAGATTTAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 316 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGCAATGCTTCCAGAAAT |
| Suggested primer 2: | GCTGACGTGGACGATGAGAT |