| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050110 |
| Chromosome: | chromosome 6 |
| Location: | 4973640 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281400 | NAH1 | Cation antiporter; (1 of 11) PF00999 - Sodium/hydrogen exchanger family (Na_H_Exchanger) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTGCTGAGACGCTGCTGCCGGGCCGGCTGCGCGACCTCATGTCCGCC |
| Internal bar code: | AGAGGAGGTTACAGAACCGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4264 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACATGTGTGTGCAAGCG |
| Suggested primer 2: | ATCTTCCCTCCCTGTCCCTC |