| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.050164 |
| Chromosome: | chromosome 7 |
| Location: | 2017546 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325761 | (1 of 2) IPR000104//IPR003439//IPR003593//IPR011527//IPR027417 - Antifreeze protein, type I // ABC transporter-like // AAA+ ATPase domain // ABC transporter type 1, transmembrane domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGCCGCCGTGGCTTATGACCATGTGCGTCAACAACACATACAGAGGC |
| Internal bar code: | TTCGATACGAAATGCTTTCCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 967 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTACGGGACTTCACCAACC |
| Suggested primer 2: | CGCCACTCCTTGACTGAGTT |