| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.050200 |
| Chromosome: | chromosome 4 |
| Location: | 3373069 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227500 | SRR18 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 2) IPR001190//IPR006626//IPR011050//IPR017448 - SRCR domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // SRCR-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCGGCGGCGGCACCATTGGCGGCGCCGGCGCGACGGCATTTGCGCT |
| Internal bar code: | AAGGGATGGCCGTCGCGAATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCAGCTTGCTACCAACA |
| Suggested primer 2: | CTGATCTGGCTCCCGAAGTC |