| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050206 |
| Chromosome: | chromosome 1 |
| Location: | 2482230 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014500 | (1 of 1) PF06293//PF07714 - Lipopolysaccharide kinase (Kdo/WaaP) family (Kdo) // Protein tyrosine kinase (Pkinase_Tyr); Protein tyrosine kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACGGTACCCGGGGCGGGCCCCATCACCCCACTGCTGCTGTACCGTGC |
| Internal bar code: | CTATGCGCTGCTTGTATTTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4692 |
| LEAP-Seq percent confirming: | 86.747 |
| LEAP-Seq n confirming: | 72 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGCAGCTGAAGGGACAT |
| Suggested primer 2: | CCCCTCCCCAAGATACTCCA |