| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.050228 |
| Chromosome: | chromosome 6 |
| Location: | 7274610 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299050 | DGTT3 | (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2); Diacylglycerol O-acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCGTGTTCTACATCCCCTTCTGGCGCCATTTCATCACGTAAGCTTGC |
| Internal bar code: | AGAGGCTCTTGCCAGTATGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2809 |
| LEAP-Seq percent confirming: | 10.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCCTAGCGTCTGACCCTT |
| Suggested primer 2: | TCTTCAAGACCTGGCGTCAC |