| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050258 |
| Chromosome: | chromosome 12 |
| Location: | 3517224 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496750 | NUO8 | (1 of 1) K03941 - NADH dehydrogenase (ubiquinone) Fe-S protein 8 (NDUFS8); NADH:ubiquinone oxidoreductase subunit 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTGGCGTTGCGGCCTACAAGGTGCTGGGTGGGCAACTACGCACAGCC |
| Internal bar code: | GGACGCTTGTATGCCAGCTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3120 |
| LEAP-Seq percent confirming: | 70.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCACACGAAACGCCTTCT |
| Suggested primer 2: | AATCGTGTTGTCTCCGCCAT |