| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050266 |
| Chromosome: | chromosome 13 |
| Location: | 3697219 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g588271 | (1 of 1) PF07556 - Protein of unknown function (DUF1538) (DUF1538) | 3'UTR | |
| Cre13.g801562 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAGCAGGTTATGCAAGGTGCTGACCAATTTAAGTTGGCTTGCTGCGT |
| Internal bar code: | CAAATGCTTCTGACCCTGAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2767 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACTGACTTTGTCTGCCGG |
| Suggested primer 2: | ATTGCCACCTATGGTTGCGA |