| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050301 |
| Chromosome: | plastome |
| Location: | 94660 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802305 | 2716992,ChreCp041,rpoB2 | (1 of 2) K03043 - DNA-directed RNA polymerase subunit beta (rpoB); RNA polymerase beta subunit II | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGAGCAGGCAGTGGCGGTACCACTGCCACTAAAATTTATTTGCCCGA |
| Internal bar code: | TTTCTGGGTAGATAGCAGAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 137 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACTGAGCTAAGCAGGCT |
| Suggested primer 2: | AGAATGGGATGGCATTGGCA |