| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050377 |
| Chromosome: | chromosome 16 |
| Location: | 836607 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g801885 | (1 of 1) K15264 - putative methyltransferase [EC:2.1.1.-] (NSUN5, WBSCR20) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGCGTGGCTTGGGCTCGAGGCGGTTACCACGGATGCGTGTCATTGCG |
| Internal bar code: | AGCATAGTAGGGGAGAGACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1405 |
| LEAP-Seq percent confirming: | 60.7143 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCACCAACACCAACACCAA |
| Suggested primer 2: | GTGTTTGTGTTGGGCAGGTC |