Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.050388 |
Chromosome: | chromosome 6 |
Location: | 2059607 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265850 | TCP2,CTPA2,TSP2,CTPC1 | C-terminal peptidase C; (1 of 1) PTHR32060//PTHR32060:SF8 - FAMILY NOT NAMED // PEPTIDASE S41 FAMILY PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGTTCTCGCTGCCGTCCCCTGCTTTCCCGCCCCGCCCAACGCACGTG |
Internal bar code: | GTAAAGACAAAATTTCTGTGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3144 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 75 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTCCAACCCATCGGTAGT |
Suggested primer 2: | CTAGGTGATGGCGTGTGTGT |