| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050397 |
| Chromosome: | chromosome 2 |
| Location: | 8365138 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g142700 | (1 of 41) PF13920 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGTTAGGAGATGGAGCGCATCAAGCGGTCCATAGGCTGGGGCGATC |
| Internal bar code: | TGAAAAATAACATTGCGAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3356 |
| LEAP-Seq percent confirming: | 73.0769 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGATGTTGTAAGAGCGC |
| Suggested primer 2: | CGTCGTCGTCCTCGTCATAG |