| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050413 |
| Chromosome: | chromosome 1 |
| Location: | 6709063 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g047950 | IFT27,Rabl4,FAP156 | (1 of 1) K07934 - intraflagellar transport protein 27 homolog (IFT27, RAYL, RABL4); Intraflagellar transport protein 27 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCCCCACCCCACCCAACCTACCGCGCCGATTTGAGCAGCTCAAACCA |
| Internal bar code: | TACTATAAGCGTGAACCGGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3826 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGATATCACCGCAACGCT |
| Suggested primer 2: | AGTTGCGGTAGAAGGTGGTG |