| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.050424 |
| Chromosome: | plastome |
| Location: | 92959 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802303 | 2717010,ChreCp039,rps9 | 30S ribosomal protein S9; (1 of 2) PTHR21569//PTHR21569:SF1 - RIBOSOMAL PROTEIN S9 // 28S RIBOSOMAL PROTEIN S9, MITOCHONDRIAL | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAAGTGTAATATGGCTTTAGCAAAAGATGAAAAAATCTCTCATTGTT |
| Internal bar code: | CGGTGGGGGCTAATGGTAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCCATTAAACCACCACCT |
| Suggested primer 2: | TGGTACTCCACGTCCAAATGA |