| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050477 |
| Chromosome: | chromosome 8 |
| Location: | 4240515 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384200 | (1 of 1) IPR000104//IPR003191//IPR009148//IPR015894//IPR027417//IPR030386 - Antifreeze protein, type I // Guanylate-binding protein, C-terminal // Streptococcal non-M secreted SibA // Guanylate-binding protein, N-terminal // P-loop containing nucleoside triphosphate hydrolase // GB1/RHD3-type guanine nucleotide-binding (G) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCACTTGATGGGTGGAAGCATGCACCCAACCCACATCGCACGCACACT |
| Internal bar code: | GTTAGGGTGTCCCTGGGGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 431 |
| LEAP-Seq percent confirming: | 44.186 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTAAACAACGTTTGCCCA |
| Suggested primer 2: | GGGAGGGGAGGTTGTAGCTA |