| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.050541 |
| Chromosome: | chromosome 6 |
| Location: | 8389156 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307900 | FAP141 | (1 of 1) PF15104 - Domain of unknown function (DUF4558) (DUF4558); Flagellar Associated Protein 141 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCACACCCCATGCACGGCTGCAGCCGTACGGCCTTTCAGGTCGCCT |
| Internal bar code: | ATCTTTCGCATGCCAGTGAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 466 |
| LEAP-Seq percent confirming: | 38.8889 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACAACTTTGCACGCCATT |
| Suggested primer 2: | CATGCCCAGAAATGTACGCG |