Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.050548 |
Chromosome: | chromosome 4 |
Location: | 3384409 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g227500 | SRR18 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 2) IPR001190//IPR006626//IPR011050//IPR017448 - SRCR domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // SRCR-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGATCGCCGACAATGCCGCCGGCGCCGGCGGGGGTATCTACATTTCT |
Internal bar code: | GGGCGAAACTCATGTGGTGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 367 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTGATGTTGTTGACGGC |
Suggested primer 2: | CTGCGTTCATGCACTCATCG |