| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050550 |
| Chromosome: | chromosome 2 |
| Location: | 1199980 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081550 | HAD | Putative 3-hydroxyacyl-ACP dehydratase (mitochondrial FAS); (1 of 1) K18532 - adenylate kinase (AK6, FAP7) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCCGGGAAGAAGTCGCAGCCGTGGTGGTCCACCACACAGCCGCCCTC |
| Internal bar code: | TGCCCCCATTCAGACCACACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1484 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACAACACATACGCGACCA |
| Suggested primer 2: | GCACGCTAACCGCAAGTATG |