| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050562 |
| Chromosome: | chromosome 2 |
| Location: | 5939457 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117900 | HEL11,MTR4 | DEAD/DEAH box family ATP dependent helicase; (1 of 2) K12598 - ATP-dependent RNA helicase DOB1 (MTR4, SKIV2L2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGCTGGAGCGTCCGCATGACCTTAGATGTGAGGAGCTCGTGTTCCC |
| Internal bar code: | GGTACCAAGAGGGATTGGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2286 |
| LEAP-Seq percent confirming: | 96.9697 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGATTACGATGGCATCCCG |
| Suggested primer 2: | GTGTGTGTGTGTGTGTCTGC |