Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.050616 |
Chromosome: | chromosome 13 |
Location: | 4196073 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g591501 | PUS2 | (1 of 2) PTHR11142:SF0 - TRNA PSEUDOURIDINE SYNTHASE-LIKE 1; RNA pseudouridine synthase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAACCCGCCTGTGCCGAATGCACGTAGGGTTTTGCTGTACCCCGAGCT |
Internal bar code: | GGGATGTAGTATACACTAATTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3202 |
LEAP-Seq percent confirming: | 80.0 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCACCACCCTTTCTGCAAA |
Suggested primer 2: | CCCCCTGCACCCATATCATC |