| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.050660 |
| Chromosome: | chromosome 11 |
| Location: | 4263875 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g482050 | FAL13 | Protein of unknown function; (1 of 1) PF09751 - Nuclear protein Es2 (Es2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTCTTTCAATGATGGCCTCGAGCTGCGAGGTGTAGGTGTCCTCGTCG |
| Internal bar code: | CATGTTTTGTACAATTAAGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1499 |
| LEAP-Seq percent confirming: | 80.6452 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACGGCAAACCACTGAAC |
| Suggested primer 2: | CCCACATACCCTCCCTCTCA |