| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050681 |
| Chromosome: | chromosome 17 |
| Location: | 388370 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g698600 | LIPG3,LIP3 | (1 of 2) IPR006693//IPR029058 - Partial AB-hydrolase lipase domain // Alpha/Beta hydrolase fold; Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCACCAACACGCCTGCTGCCTACCTTCACCCCCTCCAGGCTACGACGT |
| Internal bar code: | AAGTAACTTGCCTAGGGATGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 419 |
| LEAP-Seq percent confirming: | 44.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTTGCGCGTGTATACCG |
| Suggested primer 2: | AACTGACGAAAAAGGCACGC |