Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.050733 |
Chromosome: | chromosome 11 |
Location: | 312264 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467567 | UBQ1 | Ubiquitin; (1 of 1) PTHR10666:SF150 - POLYUBIQUITIN 3 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGATGGTCTTGCCCGTCAGGGTCTTGACGAAGATCTGCATGCCACCG |
Internal bar code: | AGAGTACGTCTGTTAGCGAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2028 |
LEAP-Seq percent confirming: | 69.8113 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGACAGAAACGGCTACCC |
Suggested primer 2: | CTGGATCTTGGCCTTCACGT |