| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050735 |
| Chromosome: | chromosome 3 |
| Location: | 2357760 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158300 | PTK7 | (1 of 112) 2.7.11.25 - Mitogen-activated protein kinase kinase kinase / MLTK; Putative tyrosine kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCTGCTGACCGCCGCCTCCATGACGGCGACGCGCTGCAGCCGCTCATC |
| Internal bar code: | GGTGGTTCTAGCTGAAACTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4134 |
| LEAP-Seq percent confirming: | 42.8571 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTCGGGCTCCTTACTTG |
| Suggested primer 2: | GTGTGGAAACGTAGGCAGGA |