| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.050769 |
| Chromosome: | chromosome 16 |
| Location: | 5311555 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683850 | GDPD1,GDP1 | Glycerophosphoryl diester phosphodiesterase family protein; (1 of 5) PTHR23344//PTHR23344:SF7 - GLYCEROPHOSPHORYL DIESTER PHOSPHODIESTERASE // GLYCEROPHOSPHORYL DIESTER PHOSPHODIESTERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGACGGAAGACCCTGCTCGCCAAGCTCACGGCAGTAGCCCCCACGCAC |
| Internal bar code: | GGGAAGCAAGCGTAACCGTTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1386 |
| LEAP-Seq percent confirming: | 55.5556 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATGACGCCCATGCAACAA |
| Suggested primer 2: | GCCCCATACGTACGCATACA |