Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.050783 |
Chromosome: | chromosome 11 |
Location: | 3599555 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g478128 | GCN20 | Soluble ABC-F domain-containing protein related to GCN20; (1 of 1) K06158 - ATP-binding cassette, subfamily F, member 3 (ABCF3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTCTCGCTCGCCCTTACACAGGGCAACTACAGCACCTTTGAGAAGAC |
Internal bar code: | GATGAGCGTGGTATGCGACATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 672 |
LEAP-Seq percent confirming: | 32.8358 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 45 |
LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTGTTTTGCGTGCGTGTG |
Suggested primer 2: | CTAGAGGGTGCGTGTGTTGT |