Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.050908 |
Chromosome: | chromosome 11 |
Location: | 800979 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467635 | MOT22 | Predicted protein; (1 of 1) PF00339 - Arrestin (or S-antigen), N-terminal domain (Arrestin_N) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGTTAGGCCCAGTCAGGCCGCCGTGTGGTCCTCCCAACGGTCACCCAA |
Internal bar code: | GTTGCGATTCTATCGGAGTCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 651 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTAACAGTGCCACTCAG |
Suggested primer 2: | GACAGTGTGAAAACCGGCAC |