| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.050926 |
| Chromosome: | chromosome 1 |
| Location: | 3742650 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024400 | TRS85 | Component of TRAPP complex, TRS85-like; (1 of 1) PF12739 - ER-Golgi trafficking TRAPP I complex 85 kDa subunit (TRAPPC-Trs85) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATAACCTGCACACGCACGCCAACACACCTGCAAAGCTCGCCAGAGTAC |
| Internal bar code: | GCAAGCGCAAGCTTCCAAGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 902 |
| LEAP-Seq percent confirming: | 42.8571 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTTCCTACGCCTTCACT |
| Suggested primer 2: | ACCGATACACAACATGCCGT |