| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.050957 |
| Chromosome: | chromosome 3 |
| Location: | 7680968 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203900 | (1 of 14) IPR013785 - Aldolase-type TIM barrel | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCACTCCTGGCACAGGCCTTTCGCCACCTGCTCTCCTGAGTCGCTAC |
| Internal bar code: | ATGGTTTGGGCGTAGTTCTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1608 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGATGTCCGCAACCTCGT |
| Suggested primer 2: | CAGCACAGGGGCAAAGAAAC |