| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051030 |
| Chromosome: | chromosome 2 |
| Location: | 6992956 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389504 | (1 of 10) PF13578 - Methyltransferase domain (Methyltransf_24) | CDS | |
| Cre09.g389541 | OPR9 | OctotricoPeptide Repeat protein 9; (1 of 1) IPR000104//IPR011237//IPR011335//IPR013584 - Antifreeze protein, type I // Peptidase M16 domain // Restriction endonuclease type II-like // RAP domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGTAAATATTTGCAAGACTTATCATAAGGAAGCAGCTAAATAAAAGGG |
| Internal bar code: | ATAGCGTCATCTAGGTTGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3117 |
| LEAP-Seq percent confirming: | 97.5 |
| LEAP-Seq n confirming: | 78 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATTGCGCAACCAGCCAAT |
| Suggested primer 2: | GGGGTAAACCAAGAGGAGGC |