| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.051046 |
| Chromosome: | chromosome 17 |
| Location: | 3414487 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g723300 | (1 of 18) K08824 - cyclin-dependent kinase-like [EC:2.7.11.22] (CDKL) | 3'UTR | |
| Cre17.g723350 | SUL2,SULTR2 | (1 of 2) K18059 - sulfate transporter 4 (SULTR4); Sulfate anion transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGGCTCGCGCCGCACGCCGGGCGCGCTGCCGGCGCCCTCCTCCCAG |
| Internal bar code: | AACTGTGGTGGAGCAGTGCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1111 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTAATGTAGAGCCGTCGC |
| Suggested primer 2: | TGTGACCCACATCGATGCAA |