| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.051084 |
| Chromosome: | chromosome 6 |
| Location: | 3474097 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278109 | FAD2B | Putative Oleate/fatty acid desaturase, _-12; (1 of 1) 1.14.15.3 - Alkane 1-monooxygenase / Omega-hydroxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAAACCAATGCAATTGGGAGCCGAGGCCGCGCATAGCGCGGGTCCTCA |
| Internal bar code: | TCGTTCGCGATAGATCGCCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 701 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCCTTTCCAGTCTTCCAA |
| Suggested primer 2: | CCGAGTGTCGCACATCCATA |