| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.051092 |
| Chromosome: | chromosome 1 |
| Location: | 3326340 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021500 | (1 of 1) K15377 - solute carrier family 44 (choline transporter-like protein), member 2/4/5 (SLC44A2_4_5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACAACGTGGTCTTCATACCCCCGTAAGCTTGCGTCGCCTGCAATTATG |
| Internal bar code: | TCAAGAATAGAGTACCGGTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2334 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGGATCTCCAGGTCAGGT |
| Suggested primer 2: | CGGAAGTGCAGAGACGTTCT |