Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.051094 |
Chromosome: | chromosome 2 |
Location: | 6115729 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g119650 | GNT3 | (1 of 82) IPR020846 - Major facilitator superfamily domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCAGGTACACGAACAGGAAGGTGGTCTGCAGGGTTGTGGCCAGCCCG |
Internal bar code: | CTAGTTTTGACCACCGATCTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 193 |
LEAP-Seq percent confirming: | 71.4286 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTACACGCTCACCTGGTC |
Suggested primer 2: | TCTGGGGAGATCGTTGGCTA |