| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051177 |
| Chromosome: | plastome |
| Location: | 170290 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802326 | psaJ,2716958,ChreCp061 | photosystem I subunit IX; (1 of 1) K02697 - photosystem I subunit IX (psaJ) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTGTCAGTCATAATTATCAGGTTATCCACAATTTTAATTAAAATGAAA |
| Internal bar code: | GGGGCGTTGGCGGAGGCGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 427 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCAACTTTAGCGGGTGC |
| Suggested primer 2: | TTGCAGCTGTTTTTGACCCC |