Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.051202 |
Chromosome: | chromosome 7 |
Location: | 2214975 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g327250 | (1 of 3) IPR000104//IPR005135 - Antifreeze protein, type I // Endonuclease/exonuclease/phosphatase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTGCCAATTAACATTGTCACCTACAACATCCGCAGCCTGAAGGAGGCA |
Internal bar code: | ACAGTAGCGTACTGGACATCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 847 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGCTGCCATAGTGTGCAT |
Suggested primer 2: | GAGGGCTTGCTGTACACCAT |