Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.051235 |
Chromosome: | chromosome 6 |
Location: | 2190979 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g266383 | HEL26 | (1 of 1) K18995 - ATP-dependent RNA helicase DHX29 [EC:3.6.4.13] (DHX29); DEAD/DEAH box helicase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGTTGGCAAGCACGCACGTGAAGGTGAACACACATGCATTCCGCCGCA |
Internal bar code: | GACTCATAACGTTCTTTTAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2104 |
LEAP-Seq percent confirming: | 70.0 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAGGACGATGAGGAGGAC |
Suggested primer 2: | GCAATGGACGCTGTCGATTC |