| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.051257 |
| Chromosome: | chromosome 3 |
| Location: | 1818292 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154250 | MAPKKK6 | (1 of 1) IPR000719//IPR001245//IPR002290//IPR011009//IPR013320//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Concanavalin A-like lectin/glucanase domain // Tyrosine-protein kinase, catalytic domain; Mitogen-Activated Protein Kinase Kinase Kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTTGCGAAGTACCGTCCGACGCACCGTTTCTCATCGGCCCTAATCCA |
| Internal bar code: | AAATCCCCCCTGCACATTCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3608 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 57 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCAAAAGCAATGGCCACA |
| Suggested primer 2: | CGCCCGATAAGTTTCTTGCG |