| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.051297 |
| Chromosome: | chromosome 10 |
| Location: | 6257415 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463350 | HRP3 | Hydroxyproline-rich glycoprotein; (1 of 1) 2.7.1.107//2.7.11.18//3.2.1.4 - Diacylglycerol kinase (ATP) / Diglyceride kinase // [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase // Cellulase / Endoglucanase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTCCCACGCCCACGCCTTCGCCCACCCCTTCGCCCAAGGCCTCGCCC |
| Internal bar code: | TTTTTTTTCGGGCATCAGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 278 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCCATGATGAAGCCGCCC |
| Suggested primer 2: | GTGTCGTCCATCCACCAGTT |