| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051326 |
| Chromosome: | chromosome 3 |
| Location: | 1788366 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g153950 | TRP12 | Transient receptor potential ion channel protein; (1 of 6) PTHR10117 - TRANSIENT RECEPTOR POTENTIAL CHANNEL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACAGTGCGCGCGCGGCGAGCAACATGATGCTTGCCGTTTCCTTCTAC |
| Internal bar code: | TAGCCCAGGATACTTTTGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4986 |
| LEAP-Seq percent confirming: | 98.7805 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 82 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGACGGCTTCAACATCATC |
| Suggested primer 2: | TGCCAATCAACGCTCTGTCT |