| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.051336 |
| Chromosome: | chromosome 11 |
| Location: | 3612036 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478156 | AP1B1 | (1 of 1) K12392 - AP-1 complex subunit beta-1 (AP1B1); Beta1-Adaptin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTGGAGTAAATCCTGCAGTGCCTGCACACCACACACGCACTGCCCCG |
| Internal bar code: | AACACCTGTTTTTGCTTGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 52.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCGTGGCACCAACCTAA |
| Suggested primer 2: | GCTCATCACTCGACCACACA |