| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.051365 |
| Chromosome: | chromosome 12 |
| Location: | 700268 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492850 | POC19 | Proteome of centriole protein 19; (1 of 1) PF10595 - Uncharacterised protein family UPF0564 (UPF0564) | 5'UTR |
| Cre12.g492900 | (1 of 3) PF01661 - Macro domain (Macro) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCTCTTCTCGTCCGATTGTCCTCTCCTCGTATACAATTCGTTACATT |
| Internal bar code: | TGGGATGAGAATGTGAAGTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 7000 |
| LEAP-Seq percent confirming: | 96.7213 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCCAAATCCGCACTGTG |
| Suggested primer 2: | GTCCTTGGACTTCTCACGCA |