| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.051373 |
| Chromosome: | chromosome 2 |
| Location: | 4451595 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g106200 | TPT5,TPT4 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 5) PTHR11132//PTHR11132:SF101 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGATAACGACAGGCCTGGCGGTGCAACAGCGCCCCCGGCCTTAGGCC |
| Internal bar code: | GGTGATACCTGGGCTAGGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3239 |
| LEAP-Seq percent confirming: | 42.8571 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCGACGCATACATTGGTG |
| Suggested primer 2: | AAGTGGATGCGCAACACAAC |