| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.051386 |
| Chromosome: | chromosome 6 |
| Location: | 7308839 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299350 | FBB15 | Flagellar/basal body protein 15; (1 of 2) PF04819 - Family of unknown function (DUF716) (DUF716) | 3'UTR |
| Cre06.g299450 | 3'UTR_intron | ||
| Cre06.g800733 | (1 of 1) PTHR10072:SF48 - IRON-SULFUR ASSEMBLY PROTEIN ISCA, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCAATATCGCTTGTCAAGGCAGGCAAACTCGGCTGGAAACAGCGGAA |
| Internal bar code: | CGTATTTGGTTTTTTACTTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3820 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTGTACATGGTGGTGGA |
| Suggested primer 2: | ACCGCTATGAGATGAAGCCG |