Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.051391 |
Chromosome: | chromosome 12 |
Location: | 2609214 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g506350 | HFO18 | (1 of 33) K11254 - histone H4 (H4); Histone H4 | CDS |
Cre12.g506400 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCACGGTGCGGGTCTCCTCGTAGATGAGGCCGCTGATACGTTTCACAC |
Internal bar code: | CAGCATGCCTTTTACTGACTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3902 |
LEAP-Seq percent confirming: | 74.5763 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATCGTGGGCGGTTGTTTG |
Suggested primer 2: | TACGAGGCTTCTGCTATGCG |