| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.051394 |
| Chromosome: | chromosome 12 |
| Location: | 4108928 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516950 | BLD12,SAS6 | (1 of 1) K16487 - spindle assembly abnormal protein 6 (SAS-6, SASS6); Bald 12 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCCCAAATAAATAGTATATGGTACGCGTTGGGCATCCATACTGTACA |
| Internal bar code: | AGTCAGACTCGCTCTACTGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6197 |
| LEAP-Seq percent confirming: | 94.8052 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGTTGTCGGCGGAGAAA |
| Suggested primer 2: | TTGTGACTGAGCTCCGACAC |