| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.051715 |
| Chromosome: | chromosome 1 |
| Location: | 4226935 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028550 | OTU1 | (1 of 1) PTHR12419:SF10 - PROTEIN OTUB-3, ISOFORM B; OTU-like cysteine protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGTAGGTACGCCGCCAGCCCTACCGCCGTGCCCTAACGCCCCACCT |
| Internal bar code: | TCGACATATTAAGCCTCGCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2385 |
| LEAP-Seq percent confirming: | 87.8788 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTTGCCAAAAGGGTTTA |
| Suggested primer 2: | CTTTCCTCTTTCCCCCACCC |