| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.051732 |
| Chromosome: | chromosome 7 |
| Location: | 2502693 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g800790 | (1 of 4) IPR007052//IPR008978 - CS domain // HSP20-like chaperone | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACAGGCGCGCCGTGCACCGCGAGGTCGATCGCGCATGGACGCCACACGC |
| Internal bar code: | AGGCCCATCGGTTCATAAGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2327 |
| LEAP-Seq percent confirming: | 16.0494 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 68 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCAGATTGCGCACATAC |
| Suggested primer 2: | CCTAGTCATTAGGCCTGGCG |