| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.051785 |
| Chromosome: | chromosome 12 |
| Location: | 2792779 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g503800 | RMT5 | Putative protine N-methyltransferase; (1 of 2) 2.1.1.127//2.1.1.259 - [Ribulose-bisphosphate carboxylase]-lysine N-methyltransferase / RuBisCO methyltransferase // [Fructose-bisphosphate aldolase]-lysine N-methyltransferase / (dimerizing)]-lysine 6-N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGGACGGAGAGTGCGGCCGGGGGCAGGGGGTCCGGGAACGGGCAGGTA |
| Internal bar code: | CGGTACAGGAGCTAGAGCTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCAGGAACACTTGGCTGG |
| Suggested primer 2: | TGCAGAGTAGACGCGTTGTT |